View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_high_29 (Length: 287)
Name: NF18549_high_29
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 11 - 269
Target Start/End: Original strand, 41892568 - 41892825
Alignment:
| Q |
11 |
cagagacattatgtgcaggtttgaagtttgaatcctagatttatcacttctccgcacttaaagtgtgtgaatctagacataatactactagnnnnnnnnn |
110 |
Q |
| |
|
|||| |||||||||||||||| |||||| |||||| |||||||||||||||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
41892568 |
cagatacattatgtgcaggttcgaagttcgaatcccggatttatcacttctccacacttaaagtgtgtgaatctagacacaagactactagaaaaagaaa |
41892667 |
T |
 |
| Q |
111 |
nnnntgcaagtttatgcggatgaaagaatttccgattgagaggtgagcacgatgaactcacgcttgagcgagagattgatgtgtagcgagtgtaagttag |
210 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41892668 |
aag-tgcaagcttatgcggatgaaagaattttcgattgagaggtgagcacgatgaactcacacttgagcgagagattgatgtgtagcgagtgtaagttag |
41892766 |
T |
 |
| Q |
211 |
aacataaactcattgccttatattttaggttcaactcaattgtgtggttgctctggacc |
269 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
41892767 |
aacataaactcattgccttagattttaggttgacctcaattgtgtggttgctctggacc |
41892825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University