View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_low_26 (Length: 326)
Name: NF18549_low_26
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 11 - 310
Target Start/End: Complemental strand, 54063127 - 54062828
Alignment:
| Q |
11 |
cataggtgggtttcccgactcttggctatatgttcagcaaaaagagttttttaagtctttaatttaattgcgactttaattacaggtgcatgacagtaaa |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
54063127 |
cataggtggatttcccgactcttggctatatgttcagcaaaaagagttttttaagtctttaatttaattgtgactttaattacaggtgcatgacagtaaa |
54063028 |
T |
|
| Q |
111 |
aggtgaaaactcaggcgaatgtgagaaatttgccaaatactaccgttctctttgccctggtgaatgggtaagcatcccttaatttttgttttaatagcaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54063027 |
aggtgaaaactcaggcgaatgtgagaaatttgccaaatactaccgttctctttgccctggtgaatgggtaagcatcccttaatttttgttttattagcaa |
54062928 |
T |
|
| Q |
211 |
gcttcttaacttactggattacttggttcgggctgactgcagatttaccttaatgtaaagattgatgttagcgaaacttaatgcgatttatggtgtttaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54062927 |
gcttcttaacttactggattacttggttcgggctgactgcagatttaccttaatgtaaagattgatgttagcgaaacttaatgcgatttatggtgtttaa |
54062828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University