View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_low_38 (Length: 264)
Name: NF18549_low_38
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 4 - 248
Target Start/End: Complemental strand, 25640592 - 25640348
Alignment:
| Q |
4 |
ttttctcttcatcaaattttatcaaacaattgagacggaaaatctaaccgatgcataaatcaatcaccgaagcgctttctgagataattcctcatggctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25640592 |
ttttctcttcatcaaattttatcaaacaattgagacggaaaatctaaccgatgcataaatcaatcaccgaagcgctttctgagataattcctcatggctt |
25640493 |
T |
 |
| Q |
104 |
cactgcgttctttcgcacgagcctgctgtggagcaacgttaacgaacgagagataagctccggcaccgaacaatgaagcaccgatagcaaacacggcggc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25640492 |
cactgcgttctttcgcacgagcctgctgtggagcaacgttaacgaacgagagataagctccggcgccgaacaatgaagcaccgatagcaaacacggcggc |
25640393 |
T |
 |
| Q |
204 |
ggttaaagcaatttccctacccgtcggcggatacgaccaatacac |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25640392 |
ggttaaagcaatttccctactcgtcggcggatacgaccaatacac |
25640348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University