View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_low_44 (Length: 245)
Name: NF18549_low_44
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33173751 - 33173990
Alignment:
| Q |
1 |
aatttagtaagaaaacccagaccaaatctcagtaaaattttaaaaaacattttcaaaaagtttgaaatttatgtaagatcgaataatttattggatgagc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33173751 |
aatttagtaagaaaaccctgaccaaaactcagtaaaattttaaaaaacattttcaaaaagtttgaaatttatgtaagatcgaataatttattggatgagc |
33173850 |
T |
|
| Q |
101 |
taaggacgatcaagtaaatgtttttgaccatggtggtccgactcacaacaaactattatttctctcgttgatattatcatgatctactcgcactagatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
33173851 |
taaggacgatcaagtaaatgtttttgaccatggcagttcgactcacaacaaactattatttctctcgttaatattatcatgatctattcgcactagatca |
33173950 |
T |
|
| Q |
201 |
tacaccctttatttctcttaacatccatgctaccttcatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
33173951 |
tacaccctttatttctcttaacatcccttctaccttcatc |
33173990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 141
Target Start/End: Complemental strand, 35886743 - 35886710
Alignment:
| Q |
108 |
gatcaagtaaatgtttttgaccatggtggtccga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35886743 |
gatcaagtaaatgtttttgaccatggtggtccga |
35886710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University