View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_low_48 (Length: 237)
Name: NF18549_low_48
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_low_48 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 42373015 - 42373197
Alignment:
| Q |
18 |
accttaaacagatatagtggagcgagcgacagtgattggtattggttggtgaacggtggtgggttgtcgtcgatggtggccggtgggtgggg-cacagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42373015 |
accttaaacagatatagtggagcgagcgacagtg----------gttggtgaacggtggtgggttgtcgtcgatggtggccggtgggtgggggcacagtg |
42373104 |
T |
|
| Q |
117 |
cactgatgcttctgtagctgctgtatgcctgtatcgtgtttggtaaaaacaatagaagaaggaaacgcgcgtgtgctgtttgtgcagttgcat |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373105 |
cactgatgcttctgtagttgctgtatgcctgtatcgtgtttggtaaaaacaatagaagaaggaaacgcgcgtgtgctgtttgtgcagttgcat |
42373197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 206
Target Start/End: Original strand, 8167 - 8302
Alignment:
| Q |
53 |
ttggtattggttggtgaacggtggtgggttgtcgtcgatggtggccggtgggtggggcacagtgcactgatgcttctgtagctgctgtatgcctgtatcg |
152 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||| | |||||||||||||||| ||||||||||||||||| || || ||||||| |
|
|
| T |
8167 |
ttggtcttggttggtggacagtggtgggttgtcgttggtggtggccggtgggtg-------gtgcactgatgcttctgcagttg--------atgtatcg |
8251 |
T |
|
| Q |
153 |
tgtttggtaaaaacaatagaagaaggaaacgcgcgtgtgctgtttgtgcagttg |
206 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
8252 |
tgtttgggaaaaacaa---cagaaggaaacgcgcgtgtgctgtttatgcagttg |
8302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University