View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18549_low_50 (Length: 236)
Name: NF18549_low_50
Description: NF18549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18549_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 4 - 220
Target Start/End: Original strand, 40373122 - 40373339
Alignment:
| Q |
4 |
tgtatatatagaaaccacttaatcgcttaaaatgatgagcttaatcgtcatgttttaattacctcgtattagaaaaattaacataaatagataattgcac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40373122 |
tgtatatatagaaaccacttaatcgcttaaaatgatgagcttaatcgtcatgttttaattacctcgtattagaaaaattaacacaaatagataattgcac |
40373221 |
T |
 |
| Q |
104 |
taaccaaaattttgaaaattagatacgaaccaacataaccgacttgaaatcgttggaaccggtgaaaaccgtttgtttcacggtttcaatcgtatccg-c |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40373222 |
taaccaaaattttgaaaattagatacgaaccaacataaccgacttgaaatcggtggaaccggtgaaaaccgtttgtttcacggtttcaatcgtatccgtc |
40373321 |
T |
 |
| Q |
203 |
aaaatagcttaattgttt |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40373322 |
aaaatagcttaattgttt |
40373339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University