View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_101 (Length: 217)
Name: NF1854_high_101
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_101 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 27 - 203
Target Start/End: Original strand, 44347361 - 44347537
Alignment:
| Q |
27 |
taatgattaaaatttgagtcactcaatactcaacttcataaacctagtttataaaagttagaaatttatcttatttacgatcacattttcagaccatgcc |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347361 |
taatgattaaaatttgagtcgctcaatactcaacttcataaacctagtttataaaagttagaaatttatcttatttacgatcacattttcagaccatgcc |
44347460 |
T |
 |
| Q |
127 |
cttgatggctatattgttagccaatgatgattatatgtctaaaatatataagctcgttgattatacgatatcacttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
44347461 |
cttgatggctatattgttagccaatgatgattatatgtctaaaatatataagctcattgattatacggtatcacttc |
44347537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University