View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_107 (Length: 208)
Name: NF1854_high_107
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_107 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 42208410 - 42208587
Alignment:
| Q |
16 |
attctcgtaaatcataatatctaacatgagaatgtgactgtactgttttagtaatattgttcaatttcccctttgaattttggtggacatggatagattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42208410 |
attctcgtaaatcataatatctaacatgagaatgtgactgtactgttttagtaatattgttcaatttcccctttgaattttggtggacatggatagattc |
42208509 |
T |
 |
| Q |
116 |
agaggtatataatagtctattattaatagtgcagctttggttttgtatatcaaagttttgttatatccataagtatgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42208510 |
agaggtatataatagtctattattaatagtgcagctttggttttgtatatcaaagttttgttatatccataagtatgt |
42208587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 179
Target Start/End: Original strand, 6917962 - 6917998
Alignment:
| Q |
143 |
agtgcagctttggttttgtatatcaaagttttgttat |
179 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
6917962 |
agtgcagttttggatttgtatatcaaagttttgttat |
6917998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University