View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_13 (Length: 484)
Name: NF1854_high_13
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 1 - 470
Target Start/End: Complemental strand, 45974782 - 45974314
Alignment:
| Q |
1 |
ccagtcgcagaaagcagatatttgcttttgtctgaatcggagtttatcaccggcgacgaaatgtttgccggaggagaaaacggcgtcgttttttggtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45974782 |
ccagtcgcagaaagcagatatttgcttttgtctgaatcggagtttatcaccggcgacggaatgtttgccggaggagaaaacggcatcgttttttggtgtt |
45974683 |
T |
|
| Q |
101 |
ggaggagtagacgaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974682 |
ggaggagtagacgaggaaagtgactttgtggttggagtgtcgttttcgattggagatttgatggagttgacgattttgtccttatcttgatctaatagct |
45974583 |
T |
|
| Q |
201 |
ttttggatgattcatccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattttcactcacgagcctcttgctgccacgta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45974582 |
ttttggatgattcatccaatcctcgctccggaaattgacgcgggaaaaagtaagttgctctatgtggcattttcactcacgagcctcttgc-gccacgta |
45974484 |
T |
|
| Q |
301 |
gcaaaccaagaaacaaacggaaacttggccgttaccgacaccgtcctcttcgctgnnnnnnnnnnnnnnnnnnnctcaacgcatgcaaatctcttattgc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
45974483 |
gcaaaccaagaaacaaacggaaacttggccgttaccgacaccgtcctcttcgttgctgttcttcttcttctttcctcaacgcatgcaaatctcttattgc |
45974384 |
T |
|
| Q |
401 |
aacaatcaaataacagcacttgaactaattattatgcataatatatagttggaagctgaattgtatttta |
470 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974383 |
aacaatcaaataacagcacttcaactaattattatgcataatatatagttggaagctgaattgtatttta |
45974314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University