View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_28 (Length: 413)
Name: NF1854_high_28
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 44767445 - 44767665
Alignment:
| Q |
17 |
aataattgatgttcaatcattagtttggtccaaaatcacttatctaaatcannnnnnncttctcctattcaaataagtggtattttagtacatacattcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44767445 |
aataattgatgttcaatcattagtttggtccaaaattactcatctaaatcatttttttcttctcctattcaaataagtggtattttagtacatagattcc |
44767544 |
T |
|
| Q |
117 |
gtttttgtattatgttttgtttgtgatttcgtcgtttaagtgatacaatgttgttgttcgcgttttggtacgtagttttgatttctcatcttattgttat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44767545 |
gtttttgtattatgttttgtttgtgatttcgtcgtttgagtgataaaatgttgttgttcgcgttttggtgtgtagttttgatttctcatcttattgttat |
44767644 |
T |
|
| Q |
217 |
gttcgtttcattcagattgac |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44767645 |
gttcgtttcattcagattgac |
44767665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 44767741 - 44767790
Alignment:
| Q |
269 |
atggtattccgaacacctttattttgtcacatttgtatgcattttgtcac |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
44767741 |
atggtattccgaatgcctttattttgtcacatttgtaaacattttgtcac |
44767790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University