View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_49 (Length: 334)
Name: NF1854_high_49
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 22 - 176
Target Start/End: Original strand, 37364932 - 37365086
Alignment:
| Q |
22 |
tattaccaataaggttgttaaatttaaaggttataaaacaaaaggtgattttcaagacacaatatcaattataatagtgctatctgactgatacctaacc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37364932 |
tattaccaataaggttgttaaatttaaaggttataaaacaaaaggtgattttcaagacacaatatcaattataatagtgctatctgactgatacctaacc |
37365031 |
T |
 |
| Q |
122 |
ataaggaatatcgttctagtgtttgttatggcgggtgtcactatgaagccatgat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37365032 |
ataaggaatatcgttctagtgtttgttatggcgggtgtcactatgaagccatgat |
37365086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 265
Target Start/End: Original strand, 37365145 - 37365187
Alignment:
| Q |
223 |
gggatggtttgcttaagcagttgttattaatttgaataatcgc |
265 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37365145 |
gggatgatttgcttaagcagttgttattaatttgaataatcgc |
37365187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University