View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_51 (Length: 329)
Name: NF1854_high_51
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_51 |
 | |
|
| [»] scaffold0522 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 11 - 310
Target Start/End: Complemental strand, 2665344 - 2665045
Alignment:
| Q |
11 |
cataggctcaattgcaagagacttaaaagtgaacagccatcaatcttctagagatgtaagcggggcgcagtggcaatgatgagtaagaaggagcagctac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665344 |
cataggctcaattgcaagagacttaaaagtgaacagccatcaatcttctagagatgtaagtggggcgcagtggcaatgatgagtaagaaggagcagctac |
2665245 |
T |
|
| Q |
111 |
atccaatggggggaatgttggaataaccggaggctcaacaggggcaacaataggggcagaagggtctacagggggctcaacaggtgcaggcgtagcaggg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665244 |
atccaatggggggaatgttggaataaccggaggctcaacaggggcaataataggggcagaagggtctacagggggctcaacaggtgcaggcgtagcaggg |
2665145 |
T |
|
| Q |
211 |
acaagggggataattggggaaagcgtaacaggggcaggaggagtaacaactacaggcgtaatagggacaggggtagaaggttcaacaggggagggcataa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665144 |
acaagggggataattggggaaagcgtaacaggggaaggaggagtaacaactacaggcgtaatagggacaggggtagaaggttcaacaggggagggcataa |
2665045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 178 - 281
Target Start/End: Complemental strand, 2665021 - 2664918
Alignment:
| Q |
178 |
acagggggctcaacaggtgcaggcgtagcagggacaagggggataattggggaaagcgtaacaggggcaggaggagtaacaactacaggcgtaataggga |
277 |
Q |
| |
|
|||| |||||||||||| ||||| | |||| ||||| ||| |||||||| || ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2665021 |
acagtgggctcaacaggggcaggtggtacaggaacaagagggtcaattgggggaaccgtaacaggggcaggaggagtaacaacgacaggcgtaataggga |
2664922 |
T |
|
| Q |
278 |
cagg |
281 |
Q |
| |
|
|||| |
|
|
| T |
2664921 |
cagg |
2664918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0522 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0522
Description:
Target: scaffold0522; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 259
Target Start/End: Original strand, 690 - 727
Alignment:
| Q |
222 |
aattggggaaagcgtaacaggggcaggaggagtaacaa |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
690 |
aattgggggaagcgtaacaggggcaggaggcgtaacaa |
727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University