View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_55 (Length: 309)
Name: NF1854_high_55
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 21 - 303
Target Start/End: Original strand, 45507297 - 45507579
Alignment:
| Q |
21 |
gcacattggacaattgtcaaaagtgcatgagcgaaattccctgatgtttcattctttattgcctgatgaattcaacttggataagtagcggttgataaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45507297 |
gcacattggacaattgtcaaaagtgcatgagcaaaattccctgatgtttcattctttattgcctgatgaattcaacttggataagtggcggttgataaag |
45507396 |
T |
 |
| Q |
121 |
agtgagagacatactatggttaagggtataaatttaaagtggttagaatagaatagaatacctttttcaatgaatgaccatagttggcatggtaaaaatg |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45507397 |
agtgagagacagactatggttaagggtataaatttaaagtggttagaatagaatagaatacctttttcaatgaatgaccatagttggcatggtaaaaatg |
45507496 |
T |
 |
| Q |
221 |
atttatggcagccaactgtgcggcactccgttggctgaatatttgcacaaaagttttctcatcagttcccagtttcttctcac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45507497 |
atttatggcagccaactgtgcggcactccgttggctgaatatttgcacaaaagttttctcatcagttcccagtttcttctcac |
45507579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 303
Target Start/End: Original strand, 50935087 - 50935213
Alignment:
| Q |
177 |
aatacctttttcaatgaatgaccatagttggcatggtaaaaatgatttatggcagccaactgtgcggcactccgttggctgaatatttgcacaaaagttt |
276 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||| ||| || | | || |||||||| ||||||||||||| || ||||||||||| |||||||| | |
|
|
| T |
50935087 |
aataccttcttcaatgagtgaccatacatgtcatgataataagaactgattgcagccaaatgtgcggcactcctttcactgaatatttggacaaaagtct |
50935186 |
T |
 |
| Q |
277 |
tctcatcagttcccagtttcttctcac |
303 |
Q |
| |
|
| ||||||||||| |||||||| |||| |
|
|
| T |
50935187 |
tttcatcagttccgagtttcttttcac |
50935213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 87
Target Start/End: Complemental strand, 26552932 - 26552878
Alignment:
| Q |
33 |
attgtcaaaagtgcatgagcgaaattccctgatgtttcattctttattgcctgat |
87 |
Q |
| |
|
|||||||||||||| || |||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
26552932 |
attgtcaaaagtgcgagaccgaaattcccggatgcttcattctttactgcctgat |
26552878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University