View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_61 (Length: 286)
Name: NF1854_high_61
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 275
Target Start/End: Original strand, 16799096 - 16799351
Alignment:
| Q |
20 |
tctgagtcggattattgatgaggggaaactcttttgcaaaactgtgattgtact--gtgactatgaatgagtctttacatataaaggagatgataagatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16799096 |
tctgagtcggattattgatgaggggaaactcttttgcaacgctgtgattctactctgtgactatgaatgagtctttacatataaaggacatgataagatt |
16799195 |
T |
|
| Q |
118 |
acattttttcactgctaaagcttttaatttataaaatgtaatggatagatttaatttataaaatgccatattagttttccagctactttttaatggacat |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16799196 |
acattttttcactgctaaagcttt-aatttataaaatgtaatggatagctttaatctataaaatgccatgttagttttccagctactttttaatggacat |
16799294 |
T |
|
| Q |
218 |
tttcaggtaggtacctcattcttcgatacaatagcttaatattttacatttccttctt |
275 |
Q |
| |
|
||||||| |||| ||||||| |||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
16799295 |
tttcaggcaggttcctcatttttcgatgcaatagctt-atattttacatttccttctt |
16799351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University