View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_66 (Length: 278)
Name: NF1854_high_66
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 8e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 112 - 183
Target Start/End: Original strand, 27423075 - 27423146
Alignment:
| Q |
112 |
cacatcatgaattccaacactgtgatttcaaccacgagccccaaaactcatcgcgtcactgcagcctcatct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423075 |
cacatcatgaattccaacactgtgatttcaaccacgagccccaaaactcatcgcgtcactgcagcctcatct |
27423146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 27422857 - 27422930
Alignment:
| Q |
19 |
aagccatttatttctgcttggattatgtgttggtggctactgctttgtagctgacaaattgtgttgtagggggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27422857 |
aagccatttatttctgcttggattatgtgttggtggctactgctttgtagctgacaaattgtgttgtacggggt |
27422930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 266
Target Start/End: Original strand, 27423147 - 27423200
Alignment:
| Q |
213 |
tacacacattcgcgagctgcaagcattcttttgcttcctattatcagtattatt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27423147 |
tacacacattcgcgagctgcaagcattcttttgcttcccattatcagtattatt |
27423200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University