View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1854_high_67 (Length: 276)

Name: NF1854_high_67
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1854_high_67
NF1854_high_67
[»] chr5 (1 HSPs)
chr5 (1-259)||(29667315-29667573)
[»] chr3 (1 HSPs)
chr3 (45-256)||(25243191-25243402)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 29667573 - 29667315
Alignment:
1 acgttaatcttaacaaaagatcttgtaaatccacatagacattatctttaaccgatttatccaaaatacaccatagccggttcttaatggaccggttcac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
29667573 acgttaatcttaacaaaagatcttgtaaatccacatagacattatctttaaccgatttatccaaaatacaccatagccggtttttaatggaccggttcac 29667474  T
101 ccatcgagccatagctagttttaatgttcgtgccgtgaactcgagggccgcggttttgcgttgcattatccatgtttcaccgtcactgttgaaaatgcct 200  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29667473 ccatcgagccatagctagtttcaatgttcgtgccgtgaactcgagggccgcggttttacgttgcattatccatgtttcaccgtcactgttgaaaatgcct 29667374  T
201 tggcccaaaagatcatgaaatgcggtttgccacttaggtcctttcgggtaattatcaaa 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29667373 tggcccaaaagatcatgaaatgcggtttgccacttaggtcctttcgggtaattatcaaa 29667315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 256
Target Start/End: Complemental strand, 25243402 - 25243191
Alignment:
45 tctttaaccgatttatccaaaatacaccatagccggttcttaatggaccggttcacccatcgagccatagctagttttaatgttcgtgccgtgaactcga 144  Q
    ||||| |||| ||| || ||||| ||||||| |||||| || ||||  ||||||||||| |||||||| ||| |    |  ||||| |  ||||| ||||    
25243402 tcttttaccgctttgtctaaaatgcaccataaccggttttttatggttcggttcacccaacgagccatggcttgacgaagggttcgagttgtgaattcga 25243303  T
145 gggccgcggttttgcgttgcattatccatgtttcaccgtcactgttgaaaatgccttggcccaaaagatcatgaaatgcggtttgccacttaggtccttt 244  Q
    | || |||||||| ||||| |  | ||| || ||||| || |||||||| || || || || ||||||||||| || |||||||||||  | ||||||||    
25243302 gtgcagcggttttacgttgaaccagccacgtgtcaccatcgctgttgaagattccgtgtcctaaaagatcatggaaagcggtttgccatgttggtccttt 25243203  T
245 cgggtaattatc 256  Q
     |||||||||||    
25243202 tgggtaattatc 25243191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University