View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_67 (Length: 276)
Name: NF1854_high_67
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 29667573 - 29667315
Alignment:
| Q |
1 |
acgttaatcttaacaaaagatcttgtaaatccacatagacattatctttaaccgatttatccaaaatacaccatagccggttcttaatggaccggttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29667573 |
acgttaatcttaacaaaagatcttgtaaatccacatagacattatctttaaccgatttatccaaaatacaccatagccggtttttaatggaccggttcac |
29667474 |
T |
 |
| Q |
101 |
ccatcgagccatagctagttttaatgttcgtgccgtgaactcgagggccgcggttttgcgttgcattatccatgtttcaccgtcactgttgaaaatgcct |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29667473 |
ccatcgagccatagctagtttcaatgttcgtgccgtgaactcgagggccgcggttttacgttgcattatccatgtttcaccgtcactgttgaaaatgcct |
29667374 |
T |
 |
| Q |
201 |
tggcccaaaagatcatgaaatgcggtttgccacttaggtcctttcgggtaattatcaaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29667373 |
tggcccaaaagatcatgaaatgcggtttgccacttaggtcctttcgggtaattatcaaa |
29667315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 256
Target Start/End: Complemental strand, 25243402 - 25243191
Alignment:
| Q |
45 |
tctttaaccgatttatccaaaatacaccatagccggttcttaatggaccggttcacccatcgagccatagctagttttaatgttcgtgccgtgaactcga |
144 |
Q |
| |
|
||||| |||| ||| || ||||| ||||||| |||||| || |||| ||||||||||| |||||||| ||| | | ||||| | ||||| |||| |
|
|
| T |
25243402 |
tcttttaccgctttgtctaaaatgcaccataaccggttttttatggttcggttcacccaacgagccatggcttgacgaagggttcgagttgtgaattcga |
25243303 |
T |
 |
| Q |
145 |
gggccgcggttttgcgttgcattatccatgtttcaccgtcactgttgaaaatgccttggcccaaaagatcatgaaatgcggtttgccacttaggtccttt |
244 |
Q |
| |
|
| || |||||||| ||||| | | ||| || ||||| || |||||||| || || || || ||||||||||| || ||||||||||| | |||||||| |
|
|
| T |
25243302 |
gtgcagcggttttacgttgaaccagccacgtgtcaccatcgctgttgaagattccgtgtcctaaaagatcatggaaagcggtttgccatgttggtccttt |
25243203 |
T |
 |
| Q |
245 |
cgggtaattatc |
256 |
Q |
| |
|
||||||||||| |
|
|
| T |
25243202 |
tgggtaattatc |
25243191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University