View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_70 (Length: 267)
Name: NF1854_high_70
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_70 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 4149 - 4377
Alignment:
| Q |
23 |
atgagaaatatgagcttaacaaagaacgtgtaaagctttgcatgctagacaagtaaccatcgaattctacttggcttcaaagctaagtgacctttatatt |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149 |
atgagaaatatgagcttaacaa-gaacgtgtaaagctttgcatgctagacaagtaaccatcgaattctacttggcttcaaagctaagtgacctttatatt |
4247 |
T |
 |
| Q |
123 |
actttacttaagtgtgacattaaatatgaaacacttttgtgagacatgaaattgacatattaattagctcct---ttgtgtgtgtcttgtttggtgcaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4248 |
actttacttaagtgtgacattaaatatgaaacacttttgtgagacatgaaattgacatattaattagctcctaacttgtgtgtg--ttgtttggtgcaaa |
4345 |
T |
 |
| Q |
220 |
aagcaattttatgaaaattatggtctctaact |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4346 |
aagcaattttatgaaaattatggtctctaact |
4377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University