View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_72 (Length: 261)
Name: NF1854_high_72
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 24908653 - 24908422
Alignment:
| Q |
16 |
cataattttacattaatatatatcatattatgcgactggtaccagaattttgcttttcagttatcgcttgatagtttaatctttgtttaacatttatctg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24908653 |
cataattttacattaatatatatcatattatgtgactggtaccagaattttgcttttcagttatcgcttgatagtttaatctttgtttaacatttatctg |
24908554 |
T |
|
| Q |
116 |
agcaggggatatcttgcgccagaatatgcgcttctaagacagcttacaaagaaagccgatgtatatagttttgggatcctgatgcttgaaataatcagtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24908553 |
agcaggggatatcttgcgccagaatatgcgcttctaagacagcttacaaagaaagccgatgtatatagttttgggatcctgatgcttgaaataatcagtg |
24908454 |
T |
|
| Q |
216 |
gtaaaagtagtagcaaagctgcatttggagac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24908453 |
gtaaaagtagtagcaaagctgcatttggagac |
24908422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University