View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_74 (Length: 260)
Name: NF1854_high_74
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 34248293 - 34248533
Alignment:
| Q |
19 |
caatagcttcttcatgtcgaaaaggatgtccatgtatcttggaaggaatcctagttccatgtccactataatgaaaataaagcacatcccctgcttcagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248293 |
caatagcttcttcatgtcgaaaaggatgtccatgtatcttggaaggaatcctagttccatgtccactataatgaaaataaagcacatcccctgcttcagc |
34248392 |
T |
|
| Q |
119 |
tttatcaaccatgcttgataatgcttgtttaatgttagcaccagttggcatagttgatgaagagtttttagg---atcatcagtgagaagctgaatattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34248393 |
tttatcaaccatgcttgataatgcttgtttaatgttagcaccagttggcatagttgatgaagagtttttaggatcatcatcagtgagaagctgaatattg |
34248492 |
T |
|
| Q |
216 |
gcatgatcaaacccaaaacgcttcaccaatgtgtccttcat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248493 |
gcatgatcaaacccaaaacgcttcaccaatgtgtccttcat |
34248533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University