View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_81 (Length: 249)
Name: NF1854_high_81
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 736397 - 736168
Alignment:
| Q |
18 |
ggatttggacaattaaactccattacactctggcttagttgtgcagccacatgattagatatacaattagcacaaaatggatggttacatgtgccactac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
736397 |
ggatttggacaattaaactccattacactctggcttagttgtgcagccacatgattagatatacaattagcacaaaatggatggttacatgtgccactac |
736298 |
T |
|
| Q |
118 |
ctctaacaatatcattctctggtacaaaatcaaaacatataccacaaaaggattttgatgactgttgagaaccagtttcggtctccatggcagctgctgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
736297 |
ctctaacaatatcattctctggtacaaaatcaaaacatacaccacaaaaggattttgatgactgtcgagaaccagtttcggtctccatggcagctgctgc |
736198 |
T |
|
| Q |
218 |
ttctttccccttcttttgttgtttgaattc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
736197 |
ttctttccccttcttttgttgtttgaattc |
736168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 48 - 94
Target Start/End: Original strand, 1455207 - 1455253
Alignment:
| Q |
48 |
tggcttagttgtgcagccacatgattagatatacaattagcacaaaa |
94 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
1455207 |
tggcttagttgttcagccacatgcttagatatacaattggcacaaaa |
1455253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University