View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_84 (Length: 246)
Name: NF1854_high_84
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 231
Target Start/End: Original strand, 34021534 - 34021757
Alignment:
| Q |
8 |
gagcagagaaatgctgaaaatggtgatgagaaatagagaaagtgatgattacagggaaagtagaggtgattggaaggatcaagacggagtctacgccggg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34021534 |
gagcagagaaatgctgaaaatggtgatgagaaatagagaaagtgatgattacatggaaagtagaggtgattggaaggatcaagacggagtctacgccggg |
34021633 |
T |
 |
| Q |
108 |
gaggtagcaacaatgaccttgctacagaagacaccgttttcggcgatttttgagcgtttccttgggtttgattctgtacgttaccggagctccaacagag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34021634 |
gaggtagcaacaatgaccttgctacagaagacaccgttttcggtgatttttgagcgtttccttgggtttgattctgtacgttaccggagctccaacagag |
34021733 |
T |
 |
| Q |
208 |
gctgaagaggctggcgtcggaagt |
231 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
34021734 |
gcggaagaggctggcgtcggaagt |
34021757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University