View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_95 (Length: 233)
Name: NF1854_high_95
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 48566532 - 48566299
Alignment:
| Q |
1 |
atataaagttattataaatataaaagttggtttgagtttttcttcattgcaacttgagtctttggatgcattggagttttaggtaattgtatgttatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48566532 |
atataaagttattataaatatagaagttggtttgagtttttcttcattgcaacttgagtctttggattcattggagttttaggtaattgtatgttatgaa |
48566433 |
T |
 |
| Q |
101 |
aggtttttcaattctttcgtgcaaaaattataattgagagtttataattttgcctctacaaacattgtatgagattgtaagttgttttcatg-----ttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48566432 |
aggtttttcaattctttcgtgcaaaaattataattgagagtttataattttgcctctacaaacattgtatgagattgtaagttgttttcatgtttgattt |
48566333 |
T |
 |
| Q |
196 |
tgcttatgtgaatgtaattttgcttttgtgaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
48566332 |
tgcttatgtgaatgtaattttgctattgtgaaaa |
48566299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University