View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_high_99 (Length: 224)
Name: NF1854_high_99
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_high_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 39272910 - 39273114
Alignment:
| Q |
20 |
acttcgatttcttctcgttcaattgttttcctcatc-------------taatttcttcttcatttttcacttgtttactatttt-ttctcatattagtt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39272910 |
acttcgatttcttctcgttcaattgttttcctcatcaatatgcaatgcataatttcttcttcatttttcacttgtttactatttttttctcatattagtt |
39273009 |
T |
 |
| Q |
106 |
aatctcttgtttgttgtagcaatcacattcacaacattattgcattcttttgccggaaccactcaattggtagcttcacatggtaatttctagaattctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39273010 |
aatctcttgtttgttgtagcaatcacattcacaacattattgcattcttttgccggaaccactcaattggtagcttcacatggtaatttctagaattctt |
39273109 |
T |
 |
| Q |
206 |
cttct |
210 |
Q |
| |
|
||||| |
|
|
| T |
39273110 |
cttct |
39273114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University