View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_105 (Length: 218)
Name: NF1854_low_105
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_105 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 53 - 175
Target Start/End: Original strand, 52126970 - 52127090
Alignment:
| Q |
53 |
attatgtggataaaagagtttttctattccaaaaactaagataaataatattgaatggtttgtactcgttttctagccttaacattgttcagtatttagg |
152 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52126970 |
attatgtggacaaaagagtttttctcttctgaaaactaagataaataatattgaatggtttgtactcgttttctagccttaaca-tgttcagtatttagg |
52127068 |
T |
|
| Q |
153 |
acgattagatttatattagccta |
175 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
52127069 |
acgattaga-ttatattagccta |
52127090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 52126846 - 52126880
Alignment:
| Q |
19 |
tttaaaagagcctccgcctaaaattatggccctta |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52126846 |
tttaaaagagcctccgcctaaaattatggccctta |
52126880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University