View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_111 (Length: 208)
Name: NF1854_low_111
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_111 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 39273291 - 39273091
Alignment:
| Q |
12 |
atgaaagtaaataagtaataagtacttatacgactgatatgacagtaactgtgacctatcgggcgactattttggaatttctctacattcaggactatta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39273291 |
atgaaagtaaataagtaataagtacttatacgactgatatgacagtaactgtgacctatcgggcgactattttggaatttctatacattcaggactatta |
39273192 |
T |
 |
| Q |
112 |
tcgctactagatacaaattcagcgacaaaatatnnnnnnnnnntat----attcatgaaatgcatattatacgacaaagaagaagaattctagaaattac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39273191 |
tcgctactagatacaaattcagcgacaaaatataaaaaataaaaataaaaattcatgaaatgcatattagacgacaaagaagaagaattctagaaattac |
39273092 |
T |
 |
| Q |
208 |
c |
208 |
Q |
| |
|
| |
|
|
| T |
39273091 |
c |
39273091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University