View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_112 (Length: 208)
Name: NF1854_low_112
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_112 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 2233111 - 2233288
Alignment:
| Q |
14 |
aaaatcaaacttcaaatttaaaggcatcttcaannnnnnnattctctaataataaacaaaatttatccaaggtactttaatttagagtaaagtnnnnnnn |
113 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2233111 |
aaaatgaaactttaaatttaaaggcatcttcaatttttttattctctaataataaacaaaatttatccaaggtactttaatttagagtaaagtaaaaaaa |
2233210 |
T |
 |
| Q |
114 |
gatgtaataaaatatagacttacgagaagttaagagaataacgaggaaaaaacaaatgctaacgattgatttcctctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2233211 |
gatgtaataaaatatagacttacgagaagttaagagaataacgaggaaaaaacaaatgctaacgattgatttcctctc |
2233288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University