View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1854_low_112 (Length: 208)

Name: NF1854_low_112
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1854_low_112
NF1854_low_112
[»] chr8 (1 HSPs)
chr8 (14-191)||(2233111-2233288)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 2233111 - 2233288
Alignment:
14 aaaatcaaacttcaaatttaaaggcatcttcaannnnnnnattctctaataataaacaaaatttatccaaggtactttaatttagagtaaagtnnnnnnn 113  Q
    ||||| |||||| ||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||           
2233111 aaaatgaaactttaaatttaaaggcatcttcaatttttttattctctaataataaacaaaatttatccaaggtactttaatttagagtaaagtaaaaaaa 2233210  T
114 gatgtaataaaatatagacttacgagaagttaagagaataacgaggaaaaaacaaatgctaacgattgatttcctctc 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2233211 gatgtaataaaatatagacttacgagaagttaagagaataacgaggaaaaaacaaatgctaacgattgatttcctctc 2233288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University