View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_27 (Length: 420)
Name: NF1854_low_27
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Complemental strand, 54014907 - 54014496
Alignment:
| Q |
1 |
actacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014907 |
actacacgtgttttggagttcttatagtaacatgctttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaagaa |
54014808 |
T |
 |
| Q |
101 |
tgggactggtaattcaacattttatcatttaacaaagtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014807 |
tgggactggtaattcaacattttatcatttaacaaagtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaacag |
54014708 |
T |
 |
| Q |
201 |
ggacaatttcttgattcttcaaacactcgttgctaccttagtttcctatattttcccatttcttcagcatcttcctctatggaatataaaaggtattatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54014707 |
ggacaatttcttgattcttcaaacacttgttgctaccttagtttcctatattttcccatttcttcagcatcttcctctatggaatgtaaaaggtattatt |
54014608 |
T |
 |
| Q |
301 |
gttgccatgattctacatgtgggagtttcagagccactttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctcttc |
400 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014607 |
gttgctatgattctacatgtgggagtttcagagccactttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctcttc |
54014508 |
T |
 |
| Q |
401 |
atcattcatctc |
412 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54014507 |
atcattcatctc |
54014496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University