View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_50 (Length: 339)
Name: NF1854_low_50
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 31884519 - 31884846
Alignment:
| Q |
1 |
taaaacggaacattgttttcgttagtgtgataaaataggacgatcaaaagtgcacttaatcctaactattaattagttttaggcattctaatgtactaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
31884519 |
taaaacggaacattgttttcgttagtgtgataaaataggacgatcaaaagtgcacttaatcctaactattaattagttttaggcattctaatgtaccata |
31884618 |
T |
 |
| Q |
101 |
acacat-------cctgaaagcttgtttgaacttttatggttgttgttgctgtacctcatgttttttgttcatgctcttatattttcactttcaattcag |
193 |
Q |
| |
|
| || |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31884619 |
gtatatgtttcctcctgaaggcttgtttgaacttttatggttgttgttgttgtacctcatgttttttgttcatgctcttatattttcactttcaattcag |
31884718 |
T |
 |
| Q |
194 |
aactgtttttggacnnnnnnnttgcattaaaaaatgtttattgtattatggtacaaatgtttatttagggtgggtcattcgacgaaactaaaagaagaca |
293 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31884719 |
aactgtttttggacaaaaatattgcgttaaaaaatgtttattgtattatggtacaaatgtttatttagggtgggtcattcgacgaaactaaaagaagaca |
31884818 |
T |
 |
| Q |
294 |
ttttatttttagtgagtgctgccgatgc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31884819 |
ttttatttttagtgagtgctgccgatgc |
31884846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University