View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_62 (Length: 292)
Name: NF1854_low_62
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 5134107 - 5134271
Alignment:
| Q |
1 |
gtgaaatgttcaaccgaacattgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaaggtgtctcatatcaacccagca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5134107 |
gtgaaatgttcaaccgaacatcgaataatatcttcttccatagctccatttcagcttcaaatgtatttgaattaagaaggtgtctcatatcaacccagca |
5134206 |
T |
|
| Q |
101 |
aaacaaaccagcattatttgtttcgagacaactaatacctgctttttgtaatccattaacaagca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5134207 |
aaacaaaccagcattatttgtttcgagacaactaatacctgctttttgtaatccattaacaagca |
5134271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 5134335 - 5134380
Alignment:
| Q |
229 |
cacctagcatagatgagaggagatattgagtttgtgatgaaaccaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5134335 |
cacctagcatagatgagaggagatattgagtttgtgatgaaaccaa |
5134380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 33 - 103
Target Start/End: Complemental strand, 40208407 - 40208337
Alignment:
| Q |
33 |
ttcttccatagctccatttcagcttcaaatgtatttgaattaagaaggtgtctcatatcaacccagcaaaa |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||| ||||| || |||||||||||||| ||||| |
|
|
| T |
40208407 |
ttcttccatagttccatttcagcttcaaatgtgttggaatggagaagatgcctcatatcaacccaacaaaa |
40208337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University