View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_66 (Length: 284)
Name: NF1854_low_66
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 267
Target Start/End: Original strand, 5951298 - 5951555
Alignment:
| Q |
10 |
catcatcagacacaagaaatggatcatgcaacagttcttttgctgatggtctccttgctgcatttactaggcattttccaataaactcgcgtgcttctgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5951298 |
catcatcagacacaagaaatggatcatgcaacagttcttttgctgatggtctccttgctgcatttactaggcattttccaataaactctcgtgcttctgc |
5951397 |
T |
|
| Q |
110 |
atcttcaattcggaaaagtgttgctggtagcttaccctgaacattgaaagatagaaaaaatacttatatattatttcgagtttactagtatcattaaact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5951398 |
atcttcaattcggaaaagtgttgctggtagcttaccctgaacattgaaagatagaaaaaatacttatatattatttcgagtttactagtatcattaaact |
5951497 |
T |
|
| Q |
210 |
ttaaaccaagttcttaatttaccgatgtcactttcttgtatatttgcgctgggttagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
5951498 |
ttaaaccaagttcttaatttaccgatgtcactttcttgtatatttgtgccgggttagt |
5951555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 22396537 - 22396679
Alignment:
| Q |
17 |
agacacaagaaatggatcatgcaacagttcttttgctgatggtctccttgctgcatttactaggcattttccaataaactcgcgtgcttctgcatcttca |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||| | ||| | || |||| || |||||||||||| |||||||||| ||| |||| |||||||| |
|
|
| T |
22396537 |
agacacaagaaatggatcatgcagcagttattttgccaaaggtttttttactgctttcactaggcatttttcaataaactctcgtacttcggcatcttct |
22396636 |
T |
|
| Q |
117 |
attcggaaaagtgttgctggtagcttaccctgaacattgaaag |
159 |
Q |
| |
|
|| ||| ||||| | |||||||||||| ||||||||| |||| |
|
|
| T |
22396637 |
atcaggataagtgcttctggtagcttacactgaacattaaaag |
22396679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 75 - 159
Target Start/End: Complemental strand, 28153921 - 28153837
Alignment:
| Q |
75 |
actaggcattttccaataaactcgcgtgcttctgcatcttcaattcggaaaagtgttgctggtagcttaccctgaacattgaaag |
159 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| || ||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
28153921 |
actaggcattttccaataaactccaatgcttttgcatcttcaaatcagaaaagtgttgctggtagcataccttgaacattaaaag |
28153837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 225 - 267
Target Start/End: Original strand, 31951650 - 31951692
Alignment:
| Q |
225 |
aatttaccgatgtcactttcttgtatatttgcgctgggttagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| ||||| |
|
|
| T |
31951650 |
aatttaccgatgtcactttcttgtatatctgtgctggattagt |
31951692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University