View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_67 (Length: 283)
Name: NF1854_low_67
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 33408639 - 33408894
Alignment:
| Q |
19 |
ttaaatacttcatcggcccaaaaacagcaaccttttctaatcaaaatatttatccaatggaatttcaaaatttgttgaatatatggactgtaactataca |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
33408639 |
ttaaatacttcatcggcccaaaaaaagcaaccttttctaatcaaa-tatttatccaatggaatttcaaaatttgttgaat----ggactctaactataca |
33408733 |
T |
 |
| Q |
119 |
gaagatatctcaatatgcatttgcttagaacacacaaagcagcattttaaccactgatttgcaaaagcataaatcttaccgataacttttttccctttat |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
33408734 |
gaagatatgtcaatatgcatttgcttagaacacacaaagcagcattttaaccactgatttgcaaaagcataaaccttaccaataacttttttccctttat |
33408833 |
T |
 |
| Q |
219 |
gatcttcctctgtaacctctgaaagagagatcgcaattgcacgatcaatttcttctctctc |
279 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33408834 |
gatcttcctctgaaacctctgaaagagagatcgcaattgcacgatcaatttcttctctctc |
33408894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University