View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_79 (Length: 257)
Name: NF1854_low_79
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_79 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 4171256 - 4171010
Alignment:
| Q |
13 |
attctgaaaagacttttattaaatatggactcgtgagttattcgtgagactatttttcgctataagcagcaatacccgttcacatttgtttcacgtga-- |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
4171256 |
attctgaaaagacttttattaaatatggactcgtgaattattcgtgagactatttttcgctataagcaacaatatccgttcacatttgtttcacgtgaga |
4171157 |
T |
 |
| Q |
111 |
ttcaaactctactccttgagattacgaagttaaactcttaccattgacttgacaaatctttgacagacatgtatataatcaattgcaaatttagtacttt |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4171156 |
ttcaaactctactccttgagattatgaagttaaactcttaccattgacttgacaaatctttgaaagacatgtttataatcaattgcaaatttagtacttt |
4171057 |
T |
 |
| Q |
211 |
ttctgaaatctgaaactatgagttaaacactttccagatgaagttat |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4171056 |
ttctgaaatctgaaactatgagttaagcactttccagatgaagttat |
4171010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University