View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_91 (Length: 241)
Name: NF1854_low_91
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 47 - 214
Target Start/End: Complemental strand, 52769761 - 52769594
Alignment:
| Q |
47 |
ggcatcactaactctcatcctaactacctaaccatactataccccatccgaagatcgaaatgaaaatgactagctgactccgtagaaatattgcaaagca |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52769761 |
ggcatcactaactctcatcctaactacctaaccatactataccccatccgaagatcgaaatgaaaatgactagctgactccgtagaaatattgcaaagca |
52769662 |
T |
 |
| Q |
147 |
cacgtaatatggtttgggctttatgttgtattcctattatggaccggcccaaggcacaacccttcatc |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52769661 |
cacgtaatatggttagggctttatgttgtattcctattatggaccggctcaaggcacaacccttcatc |
52769594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University