View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_93 (Length: 239)
Name: NF1854_low_93
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 82 - 221
Target Start/End: Original strand, 45468364 - 45468503
Alignment:
| Q |
82 |
atatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgttttatattatgtaggtgatgatccaagagatgtgaaggcac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468364 |
atatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgttttatattatgtaggtgatgatccaagagatgtgaaggcac |
45468463 |
T |
 |
| Q |
182 |
gactcaaagtgtgggcacaggcagtagcaatagcatctgc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468464 |
gactcaaagtgtgggcacaggcagtagcaatagcatctgc |
45468503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 63 - 221
Target Start/End: Complemental strand, 39220717 - 39220556
Alignment:
| Q |
63 |
ttttcaacttatttttgtaatatatgataagcgctcacgttgtaagccttcgattaattcaaaatttaacatttttgttt---tatattatgtaggtgat |
159 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| | ||| |||| || |||||||| | ||||| |||||||| ||| | ||||||||||||||| |
|
|
| T |
39220717 |
ttttcagcttatttttataatatatgataagcgcttaagttacaagcgttggattaatttagaatttgacatttttttttatttttattatgtaggtgat |
39220618 |
T |
 |
| Q |
160 |
gatccaagagatgtgaaggcacgactcaaagtgtgggcacaggcagtagcaatagcatctgc |
221 |
Q |
| |
|
||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39220617 |
gatccaacagatgtgaaggcatgactgaaagtgtgggcacaggcagtagcaatagcatctgc |
39220556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 45468327 - 45468364
Alignment:
| Q |
1 |
tcataaacaatataaaattgtatgaaaacaatttatga |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45468327 |
tcataaacaatataaaattgtatgaaaacaatttatga |
45468364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University