View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1854_low_99 (Length: 234)
Name: NF1854_low_99
Description: NF1854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1854_low_99 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 13 - 234
Target Start/End: Original strand, 41511582 - 41511797
Alignment:
| Q |
13 |
atgttttactgttaaataagatgtaattatgtatcattatttgnnnnnnnattt-atttacgcctttacatttagttttgcagtattcatggatcctctg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41511582 |
atgttttactgttaaataagatgtaattatgtatcattattagtttttttattttatttacgcctttacatttagttttgcagtattcatggatcctctg |
41511681 |
T |
 |
| Q |
112 |
aatatttgctgataaatacagtcatccnnnnnnnnnnnnnnnnnnnataatatttggctatcagaggtttgaaaatggcactttgtagaactgggccata |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41511682 |
aatatttgctgataaatacagtcatccttttttatttttt-------taatatttggctatcagaggtttgaaaatggcactttgtagaactgggccata |
41511774 |
T |
 |
| Q |
212 |
cccgattttggagacgaatgtcc |
234 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
41511775 |
cccgattttggagagcaatgtcc |
41511797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University