View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18550_high_9 (Length: 262)
Name: NF18550_high_9
Description: NF18550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18550_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 41922275 - 41922042
Alignment:
| Q |
10 |
gatggacatcatcttgcacctcacgaaccgttaaagccgaattaggtctacaagctttaagcgcctgagcggcttctgcttctagatccttccgttcaag |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41922275 |
gatgaacatcatcttgcacctcacgaaccgttaaagccgaattaggtctacaagctttaagcgcctgagcggcttctgcttctaaatccttccgttcaag |
41922176 |
T |
 |
| Q |
110 |
ttcctcaccgtccttatttctcaccaatacttcactgattaaaactctctcttcattctgtcgcgttttcaactgcgtctcctctgccgacgaaagcgac |
209 |
Q |
| |
|
||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922175 |
ttcttcaccgtccttatttctaaccaatacttcactgattaaaactctctcttcattctgtcgggttttcaactgcgtctcctctgccgacgaaagcgac |
41922076 |
T |
 |
| Q |
210 |
aacggcggcgatcggttagcggcgttgagggaga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41922075 |
aacggcggcgatcggttagcggcgttgagggaga |
41922042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University