View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18550_low_13 (Length: 240)
Name: NF18550_low_13
Description: NF18550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18550_low_13 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 34 - 240
Target Start/End: Original strand, 29049925 - 29050131
Alignment:
| Q |
34 |
agaagactatcaacattgtacatagatacatttcaaaattcaccagcctcctcacaggtcctcagggccactaatttcctgcgcatggcaattcaagctt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29049925 |
agaagactatcaacattgtacatagatacatttcaaaattcaccagcctcctcacaggtcctcagggccactaatttcctgcgcatggcaattcaagctt |
29050024 |
T |
|
| Q |
134 |
tagtcctacatagaatgataacctaagcagatcacatgggcaaacaaggactatgtgtatgatcaaataccttgtttgcaagcacagtcccgtcgggaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29050025 |
tagtcctacatagaatgataacctaagcagatcacatgggcaaacaaggactatgtgtatgatcaaataccttgtttgcaagcacagtcccgtcgggaat |
29050124 |
T |
|
| Q |
234 |
ttccagc |
240 |
Q |
| |
|
||||||| |
|
|
| T |
29050125 |
ttccagc |
29050131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 29049886 - 29049927
Alignment:
| Q |
18 |
acacacaacttatagcagaagactatcaacattgtacataga |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29049886 |
acacacaacttatagcagaagactatcaacattgtacataga |
29049927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University