View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18552_low_12 (Length: 352)
Name: NF18552_low_12
Description: NF18552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18552_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 344
Target Start/End: Complemental strand, 8831177 - 8830848
Alignment:
| Q |
18 |
ttaggggtgtaagtggcccagataaatccattgtacccgacaaaccaaccc----------gtaaatcacccgttgtttattggttcgggtcaaaaccag |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8831177 |
ttaggggtgtaagtggcccggataaatccattgtacccgacaaaccaacccaacccaacccgtaaatcacccgttgtttattggttcgggtcaaaaccag |
8831078 |
T |
 |
| Q |
108 |
attgaaattgtcaagaaccaaacacaataggtacatgtgacagattttacttatgaacccacccacctgaggagattcgtttccttaaaaggtactgcct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8831077 |
attgaaattgtcaagaaccaaacacaataggtacatgtgacagattttacttatgaacccacccacctgaggagattcgtttcct-------tactgcct |
8830985 |
T |
 |
| Q |
208 |
aatgtaagtaatatgcgtcttaacaaaaacaaaatcctcacacttcacaggcttctcctcctccttcttcgaaccacaatcatgtcatcccacaccttct |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8830984 |
aatgtaagtaatatgtgtcttaacaaaaacaaaaacctcacacttcgcaggcttctcctcctccttcttcgaaccacaatcatgtcatcccacaccttct |
8830885 |
T |
 |
| Q |
308 |
ccttcactttgtctatgccgtccactccttctgtgct |
344 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8830884 |
ccttcactgtgtctatgccgtccactccttctatgct |
8830848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 69 - 149
Target Start/End: Complemental strand, 43989682 - 43989602
Alignment:
| Q |
69 |
gtaaatcacccgttgtttattggttcgggtcaaaaccagattgaaattgtcaagaaccaaacacaataggtacatgtgaca |
149 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||||||||| || ||| |||||||||||||| ||||||||| || |||||| |
|
|
| T |
43989682 |
gtaaattacctgttgtttattagttcgagtcaaaaccaaatccaaactgtcaagaaccaaaaacaataggttcaggtgaca |
43989602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 264 - 312
Target Start/End: Complemental strand, 43985092 - 43985044
Alignment:
| Q |
264 |
cctcctccttcttcgaaccacaatcatgtcatcccacaccttctccttc |
312 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
43985092 |
cctcctccttcttcgacccatgatcatgtcatcccacgccttctccttc |
43985044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 44003291 - 44003244
Alignment:
| Q |
18 |
ttaggggtgtaagtggcccagataaatccattgtacccgacaaaccaa |
65 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
44003291 |
ttaggggtgtaagtggacaggataaatccattgaacccgacaaaccaa |
44003244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University