View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18552_low_27 (Length: 225)
Name: NF18552_low_27
Description: NF18552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18552_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 205
Target Start/End: Complemental strand, 41134299 - 41134103
Alignment:
| Q |
8 |
gaaaagaaaagaacaaaattgttatagaccaaagagaatgacgtgtgtgaaccataaagctagcttagttattcaacatgtcacgcgcgcaacgacaaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41134299 |
gaaaagaaaagaacaaaattgttatagaccaaagagaatgacgtgtgtgaaccataaagctagcttagttattcaacatgtcacgcgcgcaacaacaaca |
41134200 |
T |
 |
| Q |
108 |
acaacaacgtgggaaacaacnnnnnnnncaagtcatagaatgagtcctatcatctatgcttcttctcttctctctcacgttgccaccccatcaagaaa |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41134199 |
acaacaacgtgggaaacaac-aaaaaaacaagtcatagaatgagtcctatcatctatgcttcttctcttctctctcacgttgccaccccatcaagaaa |
41134103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University