View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18552_low_28 (Length: 223)
Name: NF18552_low_28
Description: NF18552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18552_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 1805457 - 1805646
Alignment:
| Q |
18 |
ttttaaaagtaaaataaaagtactttgaacatataaataatttatataatcaaatttgaagtattattgttataaaggatgtattaggagcatacaaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1805457 |
ttttaaaagtaaaataaaagtactttgaacatataaataatttatgtgatcaaatttgaagtattattgttataaaggatgtattaggagcataccaaaa |
1805556 |
T |
|
| Q |
118 |
ctaagttttggttcttgacctatgcataatcgactctcaaatcnnnnnnntatagtctctctattatattgattgacggttttagctctctg |
209 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1805557 |
ctaaattttggttctt-acctatgcataatcgactctcaaatc-agaaaatatagtctctctattatattgattcacggttttagctctctg |
1805646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University