View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18554_low_12 (Length: 241)
Name: NF18554_low_12
Description: NF18554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18554_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 24479329 - 24479462
Alignment:
| Q |
18 |
gaaattcatagctagtaattgatgtttaaa----ttaattaattaatcaagcttcaattgtatatgaacctgaataaatgagttatccacttttgatgga |
113 |
Q |
| |
|
|||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24479329 |
gaaattcataactagtaattgatttttaaagtaattaattaattaatcaagcttcaattgtatatgaacctgaataaatgagttatccacttttgatgga |
24479428 |
T |
|
| Q |
114 |
aggcgtattcggtgtccaacacatgtgattacat |
147 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
24479429 |
aggcgtattcggtgtccgacacatgtgattacat |
24479462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 199
Target Start/End: Complemental strand, 14956502 - 14956457
Alignment:
| Q |
153 |
taagggtttgtttggataaaacaacttatttgcagcttgtagcacaa |
199 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
14956502 |
taagggcttgtttggataaa-caacttatttgcagcttatagcacaa |
14956457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 198
Target Start/End: Original strand, 40835430 - 40835471
Alignment:
| Q |
156 |
gggtttgtttggataaaacaacttatttgcagcttgtagcaca |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
40835430 |
gggtttgtttggataaa-caacttatttgcagcttatagcaca |
40835471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University