View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18555_low_14 (Length: 259)
Name: NF18555_low_14
Description: NF18555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18555_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 39676446 - 39676675
Alignment:
| Q |
13 |
aatatcaaatctaaacaataagaaaaacaccaaaaactgcaatgatgttaaataaatgctaatctggtagctgaagcgttaatagaaatgtgtcaccatg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676446 |
aatatcaaatctaaacaataagaaaaacaccaaaaactgcaatgatgttaaataagtgctcatctggtagctgaagcgttaatagaaatgtgtcaccatg |
39676545 |
T |
 |
| Q |
113 |
tcataccaaaccgcagcgatactggacgtgctcactccggcaattgaaactcaaactcaaatgtgcaacttcaaat------------ttagttaggcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
39676546 |
tcataccaaaccgcagcgatactggacgtgctcactccggcaattgaaactcaaactcaaaggtgcaacttcaaataaaaaaaaggtgttagttaggcca |
39676645 |
T |
 |
| Q |
201 |
atgccgtaaactaaaagcttatccggaagt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39676646 |
atgccgtaaactaaaagcttatccggaagt |
39676675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University