View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18555_low_15 (Length: 251)
Name: NF18555_low_15
Description: NF18555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18555_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 47851411 - 47851183
Alignment:
| Q |
18 |
catttcaatattgaaatttgacaagaatcgttnnnnnnngatttgatctttgaatcaggggtattttcggtatgagactaaacggagaaatctcaagcga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47851411 |
catttcaatattgaaatttgacaagaatcgttaaaaaaagatttgatctttgaatcaggggtattttcggtatgagactaaacggagaaatctcaagcga |
47851312 |
T |
 |
| Q |
118 |
agaagaagaagaagtgatggagaaatctgaggtgagtacgacaccgtttttgggtcagaaaattgttgttgggtatgctttaactgcgaagaagaagaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47851311 |
agaagaagaagaagtgatggagaaatctgaggtgagtacgacaccgtttttgggtcagaaaattgttgttggatatgctttaactgcgaagaagaagaaa |
47851212 |
T |
 |
| Q |
218 |
agttttcttcaaccaaatttcatttctct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47851211 |
agttttcttcaaccaaatttcatttctct |
47851183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University