View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18555_low_17 (Length: 243)
Name: NF18555_low_17
Description: NF18555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18555_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 34 - 174
Target Start/End: Complemental strand, 40210757 - 40210617
Alignment:
| Q |
34 |
tgtgattataattaatttagattcatatatagctagttcattattagaatttccatttttggtgtattgaaagttgatttagaatcttctaggcctttct |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40210757 |
tgtgattataattaatttagattcatatatagctaattcattattggaatttccatttttggtgtattgaaagttgatttagaatcttctaggcctttct |
40210658 |
T |
 |
| Q |
134 |
ccacccattcaaatacttattttgttttttgttacacaata |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40210657 |
ccacccattcaaatacttattttgttttttgttacacaata |
40210617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University