View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18556_high_9 (Length: 327)
Name: NF18556_high_9
Description: NF18556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18556_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 19 - 159
Target Start/End: Original strand, 30874212 - 30874352
Alignment:
| Q |
19 |
aagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttctaggtcagggcgttgaaggcgatgaacaaagtgttgtgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30874212 |
aagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttctaggtcaggacgttgaaggcgatgaacaaagtgttgtgat |
30874311 |
T |
 |
| Q |
119 |
gctgaacccaagtctatgccggccatatactcaaagttttc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874312 |
gctgaacccaagtctatgccggccatatactcaaagttttc |
30874352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 239 - 313
Target Start/End: Original strand, 30874432 - 30874506
Alignment:
| Q |
239 |
gaacaattaaattatatgtaaacaggaattataaannnnnnnatagaaaagaaagtattagatttaggagtgtcc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30874432 |
gaacaattaaattatatgtaaacaggaattataaaattttttatagaaaagaaagtattagatttaggagtgtcc |
30874506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University