View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18556_low_13 (Length: 250)
Name: NF18556_low_13
Description: NF18556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18556_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 13 - 170
Target Start/End: Complemental strand, 21775100 - 21774943
Alignment:
| Q |
13 |
aatatttgagcattggttgggccagtttaggccttgaaaagcaatgaactagcccagcccggaagcatgaggacacgatcgttgcctggtctgaacgcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21775100 |
aatatttgagcattggttgggccagtttaggccttgaaaagcaatgaactagcccagcccggaagcatgaggacacgatcgttgccttgtctgaacgcaa |
21775001 |
T |
|
| Q |
113 |
gcacgaaccaaccggtcagacttcaccacggcaatcaacgaccgactggcagcagcgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21775000 |
gcacgaaccaaccggtcagacttcaccacggcaatcaacgaccgactggcagcagcgt |
21774943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 212 - 250
Target Start/End: Complemental strand, 21774901 - 21774863
Alignment:
| Q |
212 |
tttctctcacttcacttcctcactatgtcatcatcatct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21774901 |
tttctctcacttcacttcctcactatgtcatcatcatct |
21774863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University