View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18558_high_10 (Length: 237)
Name: NF18558_high_10
Description: NF18558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18558_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 45652474 - 45652680
Alignment:
| Q |
1 |
ttaccatcagatgcataatcatgcatgcatttcaatgattcatagtctctaaacaaatgaccatatccttatcagaacataaactgtctctaaacacaga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45652474 |
ttaccatcagaggcataatcatgcatgcatttcaatgattcatagtctctaaacaaatgaccatatccttatcagaatataaactgtctctaaacacaga |
45652573 |
T |
|
| Q |
101 |
caccctagtagtagttgacaacaaaccataacaaccaatttacttcaacactctcctcccccattgcaatatatctgaagtgggcttctaaagcaataca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45652574 |
caccctagtagtagttgacaacaaaccataacaaccaatttacttcaacactctcctcccccattgcaatatatctgaagtgggcctctaaagcaataca |
45652673 |
T |
|
| Q |
201 |
ttcttgt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
45652674 |
ttcttgt |
45652680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 80
Target Start/End: Original strand, 31523915 - 31523947
Alignment:
| Q |
48 |
tctaaacaaatgaccatatccttatcagaacat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31523915 |
tctaaacaaatgaccatatccttatcagaacat |
31523947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University