View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18558_high_11 (Length: 222)
Name: NF18558_high_11
Description: NF18558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18558_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 107 - 214
Target Start/End: Original strand, 27654326 - 27654433
Alignment:
| Q |
107 |
ggcaaaagaaagtttcaatctttgaggcaaatggggtgatgggttggtgagatatatagaagtacggttatgtaactgtgcaggtggtgataatggtgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27654326 |
ggcaaaagaaagtttcaatctttgaggcaaatggggtgatgggttggtgagatatatagaagtacggttatgtaactgtgcaggtggtgataatggtgat |
27654425 |
T |
 |
| Q |
207 |
ggagatga |
214 |
Q |
| |
|
||| |||| |
|
|
| T |
27654426 |
ggaaatga |
27654433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University