View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18558_low_10 (Length: 238)
Name: NF18558_low_10
Description: NF18558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18558_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 45652417 - 45652209
Alignment:
| Q |
1 |
tacttgtatcatatgtctttaacaatgttgaaagcttctttctcttgaa----------------ccttttaagtttgctttgccttttat--gtgtaaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
45652417 |
tacttgtatcatatgtctttaacaatgttgaaagcttctttctcttgaattcaaatatgctcaaaccttttaagtttgctttgccttttatttgtgtaaa |
45652318 |
T |
 |
| Q |
83 |
tggcagtcattagtattccaaaattctataagattgggactatgaagtgtatctagtaagatcagtctaacaacttaggattagaacaaaacctatttaa |
182 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45652317 |
tggcagtcattagtactccaaaattctataagattgggactatgaagtgtatctagtaagatcagtctaacaacttaggattagaacaaaacctatttaa |
45652218 |
T |
 |
| Q |
183 |
tctttcatt |
191 |
Q |
| |
|
||||||||| |
|
|
| T |
45652217 |
tctttcatt |
45652209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University