View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18558_low_12 (Length: 222)

Name: NF18558_low_12
Description: NF18558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18558_low_12
NF18558_low_12
[»] chr7 (1 HSPs)
chr7 (107-214)||(27654326-27654433)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 107 - 214
Target Start/End: Original strand, 27654326 - 27654433
Alignment:
107 ggcaaaagaaagtttcaatctttgaggcaaatggggtgatgggttggtgagatatatagaagtacggttatgtaactgtgcaggtggtgataatggtgat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27654326 ggcaaaagaaagtttcaatctttgaggcaaatggggtgatgggttggtgagatatatagaagtacggttatgtaactgtgcaggtggtgataatggtgat 27654425  T
207 ggagatga 214  Q
    ||| ||||    
27654426 ggaaatga 27654433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University